Review



plko tet on  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc plko tet on
    Plko Tet On, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 51 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko tet on/product/Addgene inc
    Average 93 stars, based on 51 article reviews
    plko tet on - by Bioz Stars, 2026-03
    93/100 stars

    Images



    Similar Products

    plko 1 shrna puro  (TaKaRa)
    96
    TaKaRa plko 1 shrna puro
    Plko 1 Shrna Puro, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 shrna puro/product/TaKaRa
    Average 96 stars, based on 1 article reviews
    plko 1 shrna puro - by Bioz Stars, 2026-03
    96/100 stars
    		  Buy from Supplier
    plko tet on  (Addgene inc)
    93
    Addgene inc plko tet on
    Plko Tet On, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko tet on/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    plko tet on - by Bioz Stars, 2026-03
    93/100 stars
    		  Buy from Supplier
    plko.1  (Addgene inc)
    90
    Addgene inc plko.1
    Plko.1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko.1/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    plko.1 - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    plko plasmid  (Addgene inc)
    90
    Addgene inc plko plasmid
    Plko Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko plasmid/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    plko plasmid - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    lentiviral constructs plko-rfp-shctrl  (Addgene inc)
    90
    Addgene inc lentiviral constructs plko-rfp-shctrl
    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
    Lentiviral Constructs Plko Rfp Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral constructs plko-rfp-shctrl/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    lentiviral constructs plko-rfp-shctrl - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    tet-plko-puro-shsox2  (Addgene inc)
    90
    Addgene inc tet-plko-puro-shsox2
    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
    Tet Plko Puro Shsox2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tet-plko-puro-shsox2/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    tet-plko-puro-shsox2 - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    plko.1 puro-shgpr43-1  (Addgene inc)
    90
    Addgene inc plko.1 puro-shgpr43-1
    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
    Plko.1 Puro Shgpr43 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko.1 puro-shgpr43-1/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    plko.1 puro-shgpr43-1 - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    plko-tet-on user manual  (Novartis)
    90
    Novartis plko-tet-on user manual
    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
    Plko Tet On User Manual, supplied by Novartis, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko-tet-on user manual/product/Novartis
    Average 90 stars, based on 1 article reviews
    plko-tet-on user manual - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    lentiviral particles plko.1 with short hairpin rnas (shrnas) containing nmnat1 and nmnat3 -specific sequences  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology lentiviral particles plko.1 with short hairpin rnas (shrnas) containing nmnat1 and nmnat3 -specific sequences
    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
    Lentiviral Particles Plko.1 With Short Hairpin Rnas (Shrnas) Containing Nmnat1 And Nmnat3 Specific Sequences, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral particles plko.1 with short hairpin rnas (shrnas) containing nmnat1 and nmnat3 -specific sequences/product/Santa Cruz Biotechnology
    Average 90 stars, based on 1 article reviews
    lentiviral particles plko.1 with short hairpin rnas (shrnas) containing nmnat1 and nmnat3 -specific sequences - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    ez-tet-plko-blast plasmid  (Addgene inc)
    90
    Addgene inc ez-tet-plko-blast plasmid
    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
    Ez Tet Plko Blast Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ez-tet-plko-blast plasmid/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    ez-tet-plko-blast plasmid - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a lentiviral vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).

    Journal: bioRxiv

    Article Title: Concerted remodelling of the postsynaptic spine and RNA granule by cLTP

    doi: 10.1101/2025.07.16.665171

    Figure Lengend Snippet: a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a lentiviral vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).

    Article Snippet: Lentiviral constructs pLKO-RFP-shCtrl (Addgene, 69040) and pLKO-RFP-shDbn1 containing the shRNA sequence GCAGTCTATCTTTGGTGACCA (TRCN0000090077) against the Dbn1 gene were used in knockdown experiments. pFUW-FLAG-APEX2, pFUW-FLAG-APEX2-DBN1 and pFUW-FLAG-APEX2-IGF2BP1 were used to perform accessibility and proximity assays, and derived from pcDNA3 APEX2-NES (Addgene, 49386) and pFUW (Addgene, 14882).

    Techniques: Immunofluorescence, Expressing, Sequencing, Plasmid Preparation, Selection